CPlasFal_353


Sequence

>CPlasFal_353 (2 EST) Length=732 TAATTTATTAGAAAACCTTATTTTGAACAAAGCAAAATATATAATATATTTGGTTTTCCCAAACCAGTTTAAATGAAACA TCGGATTCTTTAATATTCAACTACGAACGTTTTAACTGCAACAATTTTAATATATGCTATTGGAGCTGGAATTACCGCGG CTGCTGGCACCAGACTTGCCCTCCAATTGTTTCTCTAGGAACCTTGTAAATTCCTATCATTCCAATTACAAAATCATTTT TCGATATTGTATTGTTATTTCTTGTCACTACCTCTCTTTTTTAGAATTGGGTAATTTACGCGCCTGCTGCCTTCCTTAGA TGTGGTAGCTATTTCTCAGGCTCCCTCTCCGGAATCGAACTCTAATTCCCCGTTACCCGTCATAGCCATGTTAGGCCAAT ACCCTAACATCAAAAGCTGATAGGTCAGAAACTCGATTGATACACACTAAATAAAATAAATTTATNACGTGTTACTTCTT TGTTATAATTCCTTAAGTTATATATACTTTTATTCTTATAAGGCCTAACAAATACATATCCTTAAAGATAAAAATCAAAG GTATATATCAAAGCAAGTATTAGCTACAAGCTATTACGTAGTTATCCTTATAATAAAAATGTCAAGTAGACTATAACTGT TTTAATGAGCCGTTCGCAGTTTCTACATATAAAATATATATATACTTTCACTTGCATGGCTTAATCTTTGAGACAAGCAT ATGACTACTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_353: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048991675083N980492113C3czapPFDd2.1, Debopam Chakrabarti
11999042320146AA5498940967m3gmbPfHB3.1, G. Roman Reddy


Date: 11:24:25 on Sun 19 Nov 117.