CPlasFal_359


Sequence

>CPlasFal_359 (2 EST) Length=570 TATATATTTATTTATTTATTTATATATATTTTTTTTTTTTTTTTTTTTTTTCCTTTTTACCTCGTCCCTTATTTCTAATA ACCACTCATCTCTTTGTTCTTCTGTGAGCCTTGGATGTAAAATTTTAACAGCCTTTGATGCAACCAGTCCACCTTATAAA TAATAATGAAAACACAAAATATTATAAAGTTGGGAATGGGAAATATATTAAAAAGGTTGAAATGCTAATAATTATATATA CATATATAAATATATATGTCATTCTTACCATAAGTATATTTTATATTATCTGGTAACGAATCCAATGTGAGCAACATTAC AGCAACGAAATTATACGATGCATTTGGTTGTAAACTTTCCCTTTTATTATATTTCATATCTTTATTTCTCTCCATACTAT TCTCGAAAAAAAATTCATTATTTCTTAAAATATTTTTTATGGTACTATTCTGATTAATATTGATATTATTTATTTCATTC AAATTCTTTATTCCTAATTTGACAACAGTTCCTGTGATACGAATACATATTCTACGTAAAAAAAAATATATACATACATA AATATAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_359: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28980319716T098840444m7gmbPfHB3.1, G. Roman Reddy
12002922320534AA5502821411m3gmbPfHB3.1, G. Roman Reddy


Date: 8:24:5 on Wed 22 Nov 117.