CPlasFal_367


Sequence

>CPlasFal_367 (3 EST) Length=567 TTTATCTATATATATGTACATATTATTTTTGTGGTGATATATTTTCAAAATGAGTTTTAAAGAAAAGTTAAATAAAAGAA AGAAAAATGACGAAATAATATTTGAGTAAGGAAAAAATGAATATATGATATAAATATTTAAGAAATTATATATTTTATCA AATTGTTTTACAAGATAATATTCTTTTTAATATGTCTCAACGTTCTTGTTTTAAAAACACACATCACTACCTTGCACGAA TTTTTCTCCTTACGATATGTACATATATATTCACATTTTTTCTTTTTTTTTAGGGGCTATGGAAAAATACAACAAGAAAT CAAAACAAACGATGCACCAAGAGGAAGTAAGCAAGGTATGAATATTAAGTTAAAAAAAAAAAAAAAAAAAAAAAATTTCA TTTTTTTTATGTTTTAATTTTATTTTTTAATATTTTGACATATATATTTTTTTTTTTTCTTTTTATCTATTTAAGAAAAT TTATCCGAGAAACTTCCCTTTTTCTTGAATAAGAAAAAGAAAACCACGGTAAAAAATAAATAAATAAATATACATACATA TATATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_367: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28659319395T095630164m3gmbPfHB3.1, G. Roman Reddy
12005772320819AA5505671732m3gmbPfHB3.1, G. Roman Reddy
12006612320903AA5506511840m3gmbPfHB3.1, G. Roman Reddy


Date: 9:40:0 on Fri 24 Nov 117.