CPlasFal_369


Sequence

>CPlasFal_369 (8 EST) Length=1209 TGTTTTCATTTTAGTACCTATTATTCATTTGGGCGTTTTTTAAGGCTTCAATAAAGTTTTTAATATTTTCTTGCGCCGAA TTAATTACATCGTAGGTCGTATGTGAATAATACATTTGAAATTTTGTCATTTTTAAAAACATGGATCCATCTAATAAAAA TAATGCAAAATAATTATAAAAAAGCAAATCTTTTTCATTTAATTCTTTATATGTTATGGATAAGTAATGAGATGAAGGTA GATATAATGGTTTTACATACACTATAATTTTATCATTATCTTTATCATATTTTGCTGGAGGGATTTTTTCATATTCATTT ATAAAGATACAAACATTTGTGATATTTCCTAATTCTGCATCGTCTATTTTCAAGCAGTCAAACATAACATAGGAGTTTCT ATTTTTCGTAATGTAGTTGTACAGGATGTATTTAGGATAAGGTCTAAACGGGGAAAAAATATGTACATAAATAGAAATGT AAGTATATANAAATATATGTNAATATATAATATAAATATAAATATATATATATATATATATATATATATATATATATATA TATTTATAAAAGAATATTGTTTTCATTTTTCACNATTTAGTATTTTGTAATAACTGAGCTATCAAAANAATCACGTGCCA AAATTTTACAGAATTTAGAATTAATAGATTATTAGTTGAAACGAAAAAGGGAAAAGATAAAGATAATAAGAAAACTCATT TTAATAGATTAGAAGTAGATTTTAGTAATAATATGAATAGGGAAGATTATATGAAAGTAGATAGTGAATGTCGAGTGTTA GATGTAAATTCAATGAATACAAGTGATGGAAAATATGAAGTAAAAGTAACGCTGCAAACTGCATTAACCCCAAGGGATAT AAATATATATGCATTAAATAATTCTATGAATAGAAAGGAATGAGATAAAATCATAAAAGATATATATAAGGATGATAATG GAAATGACATTTCTGAGGGTACAAAAAAAATTAAGAAAAAGAAGTTTATAAAATATGTAGTGGATGTATTGGGATATGCT GTATTAATTGTTGTTTTAATACCTTGTTCCCCTTTTATTTTACTTGGAGGTATTGGTAGATGCACATTTCATTCAAAAGA ATCGGGTAAAAATTATTTTATATCTGTATGGAATGCACTGTTTTAAAAAATAAATATTTATATGTAATTAATTTTAATAT AAAATAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CPlasFal_369: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2722271395T025410155C3cbsPfHB3.1, Debopam Chakrabarti
28663319399T095670166m7gmbPfHB3.1, G. Roman Reddy
5043581674542N981760171C3czapPFDd2.1, Debopam Chakrabarti
5043591674543N981770176C3czapPFDd2.1, Debopam Chakrabarti
5043971674581N975470397C3czapPFDd2.1, Debopam Chakrabarti
12002452320487AA5502351355m3gmbPfHB3.1, G. Roman Reddy
12005932320835AA5505831748m3gmbPfHB3.1, G. Roman Reddy
12007092320951AA5506991936m3gmbPfHB3.1, G. Roman Reddy


Date: 12:34:20 on Sun 19 Nov 117.