CPlasFal_382


Sequence

>CPlasFal_382 (4 EST) Length=1559 GAAGAAAATAAAGCTCTAGGAGTTATTATAAAAAATGTTCTCACCTTAGTTTTATGGGATATCGAATCGACAGTAAGACA AGCCACCGAGAAAGTTATAAGAGATGAAGATGTGAACATTGAAACACGATTAAAACGTGCTGAAGGAATGAAATTTTTAG GAAAATTAATGCAAAAATGGTCAAAAATCAAAAACGATAAATGTGATACAAACGATATCGATGCTACCAAACTTTTAGAA AAAGCTATTATCAAAGCTTCTAAAATGCCAAACGACGAAGATCAAGCAGACCAAGATAACATCAAAAGAGAATACCTATA GAAAAAAAAAAAAAAAAAAAAAAAAAAAATAGTTGTTTAGTTATACATATATATATATATATATATATGTATATAATGTA GCAACGTGATATATTATTTCATATCAAGTCTTAAGGATAAAATGTGGAGAATATTGAGGACATTTTTGTTGGAGTACAAC ATGTAATATGTATATATGAAAAAGTAAAAAAAGGGTCACTCATGTTTATGTATACATATATATATATATATATGATATAT TATTTTTTTTTTTATTTTTTTTTTCTTAGCTAAATAATATCCTGGGGGATATAAGAAATGACGACGAAAAGTACTTCAAG TGGTTACAACTAATTTTTAGTAATTGCTGGAAAATAGAAAATGGCTGCATAAATATAACCAGAAGGAACTGCTCCTTGTC TGTGTTAACTATGCTTCCGAAAAAAGGACTACCCATAACATGTATAAGTTGCATTATTTATGCTTTAAATTATGCTTCAC ATTCTATATACTTATTTAAAAACTTTTCAAATATTGAAAATTGTAATAATGAGAATAATATAAAATTGATTAATTTAAGC AACGAAATTAGCATTATAAGAGAAAATATAATTTATCTGAACAGTTTAGAAAAGATTTCTGTTTTGAAAAATGTACAAAG CGAAATAATAGTTCTTCATATAAAAAATGGTAGTGGTTTAATAAAATTATTAAACACACAAGGACATGGAGCATTCATAA GAATTGTTAGTAATTCAATTTATGAAGTTATAAAAAGGAGCATAAATGGTTATATAAAATATGTAAATAATAATAATAAT AATAAAAATAATAGTAAAGAAAAAAAATTACCTTTGAAAAATAAAATGAAACATATAACAAAGAATGAATCTAATGATAA TATTACTTTTAATACATATACAAGTAACAACATATATTTGAGTAAATACAAATATGTACATCATAAAAATTATTATTATC CTGATAGTTGTACAAATCTAAGAAAAAAAAAAAATTCACTTTTTTATAATCTAAAAAAATATATTTATTATGAAAAAAAG AAATATTTACAGCATTGTTTATTAAAACATGATAATTATAAAAAGGTAGAGTTACCAAGAATTAAAGATATAAATTATTC TTATCAAATGGAATCTATAAAAACACGAAATTTTATTCATTCCCTAAGTGAACAATTTGCTATTTTTTCAAATTTAATTC TGTCTTTTTATATTATAAAAAATGATGACAATAATGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_382: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000312320273AA5500211100m3gmbPfHB3.1, G. Roman Reddy
12002062320448AA5501961312m3gmbPfHB3.1, G. Roman Reddy
12002412320483AA5502311351m3gmbPfHB3.1, G. Roman Reddy
12003842320626AA5503741520m3gmbPfHB3.1, G. Roman Reddy


Date: 18:54:27 on Sun 19 Nov 117.