CPlasFal_386


Sequence

>CPlasFal_386 (2 EST) Length=929 ATCAATTAACATCTGATCATTAAAATCGNGTAAGTTCAAAACCTTTTTATTAGTTCGTAGGATAGTTAACATATCGGATA TATTTCTTCAATTTTTATTAAATAGAAAAAAAATATACAACATGTATAAATATATATATATATATATGTATCCCTTTTAA TGATGAGAATTTTATATTGTTTAAAAATATGCTTTCTTTACCTTATATAGGAAAGAACTTGGTCCTTTAAAGGTTTCACA TCTATATTATTTATTTCATGGGGTTCATTAATATCATAGTCTTTTTTTTGTGTATATGAAAAAATGGCAATATCATTTTC TTCTTCATATTTTTTATATATATATTCTTCATCGGCGTATAAAACAAAAACATGAGATGGTAAATATTTGAGACAGCTAT ATGCTTGAAGATTATTGTTGGGATATCCTTCCACAATATAACCTTTCTTTTTCTTTGAGTCTAAGTTATGTATGTTCTCT TTAAGGATAAAAGAAATGATTTCATCATTAACTAGAAAATAAATAAAAAGTAAAATATATATATATATATATATATATAT ATGTTTGTGTTCTCATTTTATACATATTATTATTCCTTTTAAAATGATACCTTCTCCTTTTACATTCCATATCCTCCTTG AACTTCCTAAGACTACACAAAAATAAGCCCTCGTCATATTTCTCATCTTTCAAATATTGCACATCCAACCAATTTAATAT AAAATCATCCTTTGGGTGAGTAAAAAATTCCAAAAGTAAAAAGGCACAAAATAAATATTTTTTCTGCTCATAATATATAG TACATAAAAAGTATAAAATTATTAAAGATAAACTATTTATTTCGTTTATCTTTATTATACGAAATAATTCAATCAAAAAA TTTAAAATAAAATCATATAAAAACGAAATACTATCCATCTTAAAATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_386: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002722320514AA5502621384m3gmbPfHB3.1, G. Roman Reddy
12004292320671AA5504191570m3gmbPfHB3.1, G. Roman Reddy


Date: 21:37:19 on Fri 17 Nov 117.