CPlasFal_388


Sequence

>CPlasFal_388 (2 EST) Length=555 TTTATTATATATTCTCTTTTTTTATGGACGGTTCAAAGATATTCGTTGTGTCTACAATATTGTATACAAATTTTTTTAAA ATGTGGAGAAAAAAATTTATGTATACATGTCAGAAAAAATTTCTTAATATATAACCACCAGTGAAAAGATTTACAAGTCT ATTTTTCAAAAATGAAATTATCTCATCTTATTATATTAAATTATTTATTTTTTGGTGTGTTAATTAAAAGAAAAGAACAT TTTTAAAAATATATAAAAAAAAAAAAAAAAAAAAAGTCCCATGTTATTCTATGAATATATAAAATATGTATATGTATAAA TTTATTTATTTTATTTTTATTTCAGATAATTTAAATGGTGTTCGAAGCAACAACATATCTCATAAAGAAGGTACACCATA AAAGATTTAAGTATAAACATAAGTATATTATATATATATATATTTTTATTTTTATTTTTTATTTTTTTTGAAGACGATTG TGGAGCTTCCGAACTAGCAATAAAAAAATTACAAGAATTAAAAAAATTTGAACTTGACATTTTAAAAGATTTATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_388: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001052320347AA5500951194m3gmbPfHB3.1, G. Roman Reddy
12001262320368AA5501161215m3gmbPfHB3.1, G. Roman Reddy


Date: 13:39:9 on Thu 23 Nov 117.