CPlasFal_394


Sequence

>CPlasFal_394 (3 EST) Length=894 GTTTATATTATTTTAGCATCCAAGTAATTTTTTGTGTAATATGTAATTCTTATTTATTCATTTTATTTTTTTTTATTCAT TTGTACTAACATTATTTATATAATTATCCATTGAATATTTTTCAACATTTATATTATCATTTTGATTGTATTCCTCATTT GTATCATCCCTTTTTATGTTTTCCTTATTGTTCTCGTCTTCATTTATATTATTCTCATCAACCATTTATACTGTTCTCAT CACCATTTATATTGTTGTCATCACCATTTATATTGTTCTCATCACCATTTATATTGTTCTCATCTCCATTTATATTGTTC TCATAACCATTTATACTGTTCTCATCACCATTTATATTGTTCTCATAACCATTTATACTGTTCTCATCACCATTTATATT GTTCTCATAACCATTTATATTCTTCTCATAACCATTTATACTGTTCTCATCACCATTTATATTGTTCTCATAACCATTTA TATTCTTGTCATCACCATTTATATTGTTGTCATCACCATTTATAGTGTCGTCCATCTCCATTTATATTGTCCATCGAATA TTCATTGATCAACCAGTGTACAAAAGCCTCAGCCTTTCTAGCACATACCTGATCAGTCTTAATATTTTCCAACTTATCCT TTATTTCAATATGTTCTTCCTTTTGATTAAAATTAAACATACAATTTTCCATATGATCATATATTTTTTTATTACCCTGA TTTATATATTTTTGAACATTTTTAATAAATTCATCTTTATCATTGTTTAATAAAAAAAGCGCTTCTTGATTTTCTACCGT TTCTTTATTATATTCCTCTTGTAAATAAAAAAGGTTTTTTATGTATAAAAATATAAGAGACATATAATGGCAACTAGGAT CCCAGTTCGAGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_394: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045871674771N977531198C3czapPFDd2.1, Debopam Chakrabarti
5047541674938N979201539C3czapPFDd2.1, Debopam Chakrabarti
12006732320915AA5506631900m3gmbPfHB3.1, G. Roman Reddy


Date: 14:30:20 on Sun 19 Nov 117.