CPlasFal_411


Sequence

>CPlasFal_411 (2 EST) Length=602 ATGTAATCTATATTGTTTTAAAGGGAAATCTAAGAAAGCTATTTTTGCATTCTTAATAACTGTTGGCATAGCTTGAGAAG CTCTACCACTCATTATTGCATAACCTTCAATTAGTTTAGAATCTAATGAACTCATACCGTGTACTTTTATAACATTAACT GATGATACAGGGTATTTTGTTTTACCTGACTCGTTAATAATTTTTACAGATTGAATTGCATTAGCAACCATTTTTGCAAA ATAATCTGATTCATAACTAATAAATTTAGATGATAAGGTTGTTTTAGCAATATTGATAATAACATCCTTTCCTAAGTTAC TAACTCTTTCACTTAATTTCTCTTTTATATATTTAACTGATTCTTTCATAGCTAATTTATAACCACAAATAACAGTTGTC GGATGAATATCCATTTTTATTAATTCATTACCTCTTCTCAACAATTCAGAAGCTAATAACACAACAGATGTTGTACCATC ACCAACCTCTTGATCTTGTAATTCTGAAAGATTAACTAAAATCTTCGCAGCAGGGTGTTGAACTTCTAATTGTTTTAATA TTGTAGCTCCATCGTTTGTTATAGTCACATCCCCAATATTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_411: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048011674985N979511712C3czapPFDd2.1, Debopam Chakrabarti
12001452320387AA5501351237m3gmbPfHB3.1, G. Roman Reddy


Date: 17:6:58 on Wed 22 Nov 117.