CPlasFal_413


Sequence

>CPlasFal_413 (3 EST) Length=627 AAAGTCGCAATTTTAATCATAACATTGGAAATAATAGTAACGTGACTACTGATATTACTAATTTTTTTGATAACCTATCA AAAGNCGAAAAAAAATATATAATCATCATAATTATAATAGTACTGCTAGTAGTATTATTAGTAGTAATGCAACTACAAAA TATAATATGAAAAATATTAGTAATTCAGTTATTTCGCAATATATTTATCATAATACAAATTCTGCGGACATTGTAAAAAG TATTCATACAAGTAACAACATATATCATAATAAATATAAAAAAAAAAATAAATACGATGATGATCAGAATTTTATCGTAT CAGATGACAAACCTCATATTAATTCAAGTTATAATTTAAATGAACAAAATAATTTATTTAAAAAGAGAAAATTAAAAAAT GAGTGTCTACCAAATATATATAACAAAAATAATAAATATCTTGAAAAGAATAAAACAAAATCTATGGATTCAAATAATAA GATACAAAAGACGCATAATTTTATATGTATTATATCATCGGAAGAGGAAAATGGTTGTTAACATATTAAAACGTAAAATA AAAATATCATGTAAAATATAACTTAACCNTANANCNATATTTAATAATAANGCCACGATTATATGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_413: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44064462811T180250374c3cbsPfHB3.1, Debopam Chakrabarti
44114462861T180750458c3cbsPfHB3.1, Debopam Chakrabarti
11998712320113AA5498610934m3gmbPfHB3.1, G. Roman Reddy


Date: 19:7:40 on Thu 23 Nov 117.