CPlasFal_416


Sequence

>CPlasFal_416 (2 EST) Length=824 CATCAACTATTTCATTTTCCTTATCAACTCCATTAGTCTTATCCACACAATTTTCATCAATCTTATTATAAAATTTTAAA GTATTTAATAAATATTTTACAGGTGGGTATATTCCATCAAAGTCCATAGACTTATAATAATTATAGCAATTTAAATCTGA ATAAAGAAAAGAAGATTGTAAAGAAAACTCATATACACATAATTGTAAAGCTTGTCTATATATAGATGGACATACTATTT TTTCTAATAATATTATATCATTGATTCTTTTCGAAACAACTTCATTTATTTCTTTCTTCCTATTTTCAAGACATTTTTTA AAACCTATATAATCACTTATTTTTTTAAAAGCATTTTTTCTCTTTATTAAAGTTAAAATATTTTCTTTCTCTTTTTTTGC CTTTTCAATAAAAAAATCTTTATTCACAATAACTTGTTTTTTCCCACTTAAATTAATCCTTCTATTTTTACTTTCTCCAT CAAACATAGTTTTTTTTCTTTTTTTCTTTTTTTCTTTTTTTTTTTTTCAATATTAAAACAAAAATATATTATAGCCNAAA TTCTATGTTATNATATATGGNACTATATCTACACCCCTTACGNATTTCCACATTTTTCAAATTTNGTACTTCAATTTTCN CTATTTNATGANCAGTGATGGATACGCCATTAATTTTAAAACTAGCATAGGCTACAAAATTAAAGNGAGGTTATAAGTNA AAATTATTNAATGGGGATATTTGATATGTATTTTNCATTTGNTTCATATCATTTTGTTCATGTGTAGGGNCCCTATAAAG GTTTTATGGGCATACCATTTGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_416: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28741319477T096450217m3gmbPfHB3.1, G. Roman Reddy
12003872320629AA5503771523m3gmbPfHB3.1, G. Roman Reddy


Date: 23:45:25 on Sat 18 Nov 117.