CPlasFal_429


Sequence

>CPlasFal_429 (2 EST) Length=537 TAATTAATATTTATAATTTATACATTTGTAGGAATATGTACCAGTAGTTTTCACGGAAATGTACTAAAGAAAAATTAAAA TAATATAATAATAAATGGCAATTTTTAAAAAATATCGTTTCAGAGAAAATAAAATAATTTTTTTATTCTTTATTAAAATA TTTTTATTTTCTCTTTTCATATGGGAATTATGTTGTTTTAATAAGGTAATATAGGAATAATATAAAAAAGAAGAAGAAGA ATGAATATAAATATGAAAGATAAATATAGAATTGATTGTAATATATATATATATATATTAATTGTTAATATAAAATTGTA TGTTAATTTGTATCGTTTATTATAATTTTAGGAAAAGTTCCAAGATCAAATTCAGACGAGTTATTATAATAAGAACAATA CTTCAGGAAATGTTTCTAATTTAATAATTAAGAGAAATCTAGCACAGACTCAAAGAAATTTCAAATCAAAAAATGGAAAG GCATCTACTAAGAAAAATGAAGTAAGATATTATAAAAGAAAAGAATAAGATTATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_429: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28620319356T095240116m7gmbPfHB3.1, G. Roman Reddy
11998742320116AA5498640937m3gmbPfHB3.1, G. Roman Reddy


Date: 3:53:22 on Sat 18 Nov 117.