CPlasFal_470


Sequence

>CPlasFal_470 (2 EST) Length=639 TGACGATGAAGAAGAGAAAAATACACCTAATAATACTATAAATAGTAATATGGGTAACTTAAAAGTTAAATCTCTAAGAA TTAATGATGGAAACTTGAAAAGAGAACATCAAAGTATTTTCTCAAACGATTATGAAAGAGTTTTTGTAGATTCTAAAAGT GAAAAATGTGATGATGATATCTTTTTAGATGCAAAAGATGGTAATGTTTATACAGGGGATGAAGAAGAAGAAATAGATAT AGATGCCATATAAAATCAATACAACATGAACTAAAAAATTTTTAAATTATTCTCTCCTTTAAAATGTATGAATGAATCAA TCGAAGAATAAATTTACTAATATGTATAATATATGTAGAAATATATTATGATGTGTTCTTTTTTTATTTCATTTTATATT ATTTCTTTACTTTTTTTTTTTTTTTAAAATATAATTTTTTAATAACTTGAATTTTTTTTTTTTTTACCCTTTATATTAAG TTTTAAAAATTGTTATTATTTATTTTTTTTAATCATACGAAAATATATTTAAAACGCTCCTCTTTATTCTTATCATTTCT CGAAAGGTGTTTTCGTTTCCATGCAAGGCTTCAAATTCTCTCCAATCCTGTGAAAAAAAAAAAAAAAAAAAAAAAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_470: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004682320710AA5504581611m3gmbPfHB3.1, G. Roman Reddy
12006132320855AA5506031772m3gmbPfHB3.1, G. Roman Reddy


Date: 10:26:55 on Mon 20 Nov 117.