CPlasFal_481


Sequence

>CPlasFal_481 (3 EST) Length=570 AGGAATTCTCGTAACAATATGGAAGATGAAAAACAACAAAAAGCTAATATGGATGCATTGGAAAATACGAAAAGAAAATT AAAAGAGATAATTGAAAAAGAAGAGGAGCATCAAAAAAAACTTAAAAGAAGTGAATTGTATAATTATTAGATAGTTGAGT TTTTAACATTGTTTTATTTTTTAATGTAATATCTGATATAAAATACAATTAGGGTTCATAAATATTTGATGACATACATA ACTATAAAATATATGTGTTATTATATATTTTATAAATTTGTATATAATAATTATAAAACGGGATTTTTCCATACTATATA TATTACATATATTTATATTTTCTTTTTCTCTTTGTATTACTTTTCTTTTTTTTTTTTTTGCGGTGTGTTTAATTTGTTAT TTATTTATTTCATTTTTTTTTTTTATTATTCCACAAAAAAGGAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAT CATGTGAATGATGCATATTTTGTGAACCCATAATTTTTTATTCATAATATATATAATATAAGTATAAGCATTATTGTGCA CATAATTATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_481: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5042651400126N974170651M7gmbPfHB3.1, G. Roman Reddy
5042951400156N974790803M7gmbPfHB3.1, G. Roman Reddy
12004022320644AA5503921540m3gmbPfHB3.1, G. Roman Reddy


Date: 20:44:30 on Wed 22 Nov 117.