CPlasFal_495


Sequence

>CPlasFal_495 (2 EST) Length=502 TCATTTCAAAAATATAAAAAAAAAGTTCAGGAAGAAAATTTTATTCCGAACGAGATTGAACCTTCTTTTGGTATAGGGAG ATTAATATTTTGTATTCTAGAGCATTCGTTTAGAATTCGACGGTTTACTGATGATAAAGAAGAAAGACAATATTTATCAT TACCATATAAATTAGCTCCTATCAAATGTTCTATATTATCAATATCAAATAATAAAGCATTCTATCCATATATTAAACAA ATACAAATGTTATTAAATCAATATAATATATCATCAAAAATAGATAACTCTAGTGTATCTATAGGTAAAAAATATGCAAG AACCGATGAAATCGGTATACCCTTTGCTGTAACAATCGATTTCCAAACACTAAAAGATTAAAACCATTACCATTAAGGAG AAAGAGATTCTATGTTACAAATAAGAATAAGTATGTCTCACTTGGTAGATATTATTAACTTCTATGTTACATGCAAAAAA AAATTGGAATGAGTATATAGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_495: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2729271402T025480165C3cbsPfHB3.1, Debopam Chakrabarti
11999642320206AA5499541031m3gmbPfHB3.1, G. Roman Reddy


Date: 14:11:14 on Fri 17 Nov 117.