CPlasFal_505


Sequence

>CPlasFal_505 (2 EST) Length=497 AAATTTCTTCTCGCATGACAAGTATTTCTAGGAAAATCAGATCTGCGATTAACCCTTGGAGCAGCATTCATATCAAATCG TGGATACCTAATTACATTGTTCTCATGTACATTTCCATCTCTTTCATTATTTGCATAAAATACCCTGTCCTTGTTACATA ATCGTACATTTAATGGTCCAAAATTTGTGCTTCTTGCAGAAGGGTCATCCATTGTTGAATAAAGCTGATTCGGCATTAAT TCCTCGGAAATTTGTGCAGCACTATTATAATTAGGAATATTCATATTGTAATTATTCCATACGGGCATCGTCATATTATT AGGAAACACGTATTCTGTATCATAATATTTGTCACCAAAATTAGGAGTTGTATCCATATTACGGCAATACACATTTTCCT NACCTTTATGAGGCATTATACATGTCCCTTCAGCATATGAATTCATCTCCTTGTAATTATTCAAGTCCGCCATAATATTA AGAAGACAGAAAGGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_505: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2831319168T026490022M3gmbPfHB3.1, G. Roman Reddy
12001552320397AA5501451258m3gmbPfHB3.1, G. Roman Reddy


Date: 14:7:42 on Fri 17 Nov 117.