CPlasFal_514


Sequence

>CPlasFal_514 (2 EST) Length=645 ATCTATTAATCAATTTAAGTAAGGATAACTTGATTCGTCCCCATAGTGATAATAATAATAATAACAATAATAATAATAGA ATTCATTCTAACCCTATGATTAATAATAATATTTTGTCTCATAATATGAATGGAATGGATTATAATGGTATATATTCCAA TGATAGAAAAAATTATAATAATAATAATAATATTATTAATAATGAACATTTAAGCAGAGATATATACAATGATGGTATGG CTAGTTCGTATAATCATATGAACAAAAATGTTCATTCACAAAATTATACAAGGATGGGAGATCATTCCATGGATTCTCCA AACTATATGAATAAATATAATATGAATAATAGACATAATTCAAACGAGGCATCAACAAATAGGCAACCCTTTCCTCAGTA TGGTCCAATAAATACACCACCATCCATAAATAAAAAAAATGCTAACAATAATAATAATAATAATAATAATAATAAATATT ATAATAATGAAGACAATTTAACAAATGATAAATTAATACATANTTATCATCGTGATAATGATATATTAGATATATNACCA TTAAGTTTTATTATTACTATAANAAATTATGAATGGNAANAGAGACTTAGAAAAGCACATAAATCTTTATATATAATNAT TATAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_514: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5043001400161N974840819M3gmbPfHB3.1, G. Roman Reddy
11999212320163AA5499110984m3gmbPfHB3.1, G. Roman Reddy


Date: 21:43:10 on Fri 17 Nov 117.