CPlasFal_521


Sequence

>CPlasFal_521 (2 EST) Length=482 ATAAATAGTTTGACCAATTCCTTTCATTTTATTTTTATAGTTCATATGTTTATTTCTATTTTATGTCTTTTAATTTGGTT ATTGATTTCCATTTAAAAACGAAACATTTTAATATCTCATAAATGAGAAAATATCATACAATACAAGGTATGACTTATCT TACAATTTATATTAATATTTTACATTTGTATATATGCAGACATGCTAAATTATAACTCTCATTTTTTTATAGCTTTTTTT TTTTTTTTTTTTTTTTCCCTTAAATAGCTATTTTTCCATTTTTTTTCCTGAACGTGCAGGAATTTAAATATTATTAATTT TCTCATTTAATAATATATAAATGTATATTTTTATAATTGTTACAACAACAAACAACGATGAAGATTTTTAAATATTTAAT TTTATCTTTATATAAATTTGAAATTAAAAATTTAAAAGACGTATAAAAAATATATTCATCTCAACAAATATATATATATA TA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_521: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28945319681T098490425m3gmbPfHB3.1, G. Roman Reddy
12004652320707AA5504551608m3gmbPfHB3.1, G. Roman Reddy


Date: 14:0:44 on Mon 20 Nov 117.