CPlasFal_523


Sequence

>CPlasFal_523 (3 EST) Length=1336 CCCCCCGTAGATGTTGAAAGGGATATTAANTCACATTCAAAGCAGACCCCATTATTCTGGGCCATATGCTCAAATAATAT TCTTATGATATATATTTTAAATAAGTATGGAAGTAATTTATTTCAAGAAGATGACAAAGGATATAATTGTCTTATCATAA GTATTCAGTATAATCATATTTTAGCTTTTTTTTATTTACTATATCTAAATATTGCTATAACACATAAGGATTATAATAAT TGTACGGTAATTGATTGGGCAGCATATAATAATAATTTATTCTTCCTTCGTTTTTTTTCAATATTTATGAACAATTTATA TTCTCTTAATTTAAATACTCCAACATCAACATTACACAAAGCTATAATTGGAAACTCGTATGAAGCATGTGTATATTTAA TTATGAACAAGCATCAAAATGTTTACGACATAGGAACGGATGACAAGGTAAACAAATAAAATAAAAAAAAATAAAAATAA ATTTGTTCCAACTTTTTATGTTTTGAGACACATTTTTTTTTTTTTTAAATATAAGTGTATATAAAAAAAAATATAATCAT ATTTTTTTTATTTTGTTCTTGATACCTTACAATAGTATATAATATAGAAATGGAATCACAAAATAAAGCTTCTAGTCCAA GCATAAATGTGGATGAATATTCAAGTCTTACAAGCAACAATGAAAATCCACAAAATACCGCTACTCTTACGAATCTAACA CCTGATCAAATAAGTGCATTGAATGCGCATTTACCAAATGAAATAAATATAGAAACAATTACTTCTACATTGACAACAAA TAACGAAAATGAAGTAAATCCATTAGTACCATCATCAATTTCAAATACCCTAGATACATTGACATTTTATCAATTAATTT TGATAATTATTTCTATTGTTAATTTTTGTGTAAGGAAAATAAAATAAAATAAATATTAATAATAATAATAATAATAATAA TAACACAAAAGAATATCTTAAAGATACAATAATGTACCTCAAAGAAGCTTATGTAAACGAAGAATTAATATATGAAAAAT CCACAGCATGCATGGNTTTAAGANTTTTAAAATTATTTAGAGAATTTTTTGCTAATAAAACTGTTACTCTACCATCTAAT TTATTATCTAGAATGCAAAATGTATATTTAATTATATGCAAAAAGTTATTGTATTACCAAAAGANTCAAAAAGATATGGN AAAAAATATTAATAATAATATGGNCATAGGGCATAAAANGGAAAANGGCAGCGNCCATAAAATTTTNTCGGTTAATGCTT TTCNTTTAATGGGTACCAAAACCCATTCTTTCCTCCNTTTCCTAAAATGGTTTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_523: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2942319278T027600099M3gmbPfHB3.1, G. Roman Reddy
11998532320095AA5498430916m3gmbPfHB3.1, G. Roman Reddy
12005352320777AA5505251684m3gmbPfHB3.1, G. Roman Reddy


Date: 21:50:5 on Sat 18 Nov 117.