CPlasFal_524


Sequence

>CPlasFal_524 (3 EST) Length=1164 TTCTTTTCTTTTTCTTCATAATTTAAATTTACCTGACTTGTGCAGGTAAAATAAATGGACACTTGTTTATTTTGANTTTT AACAACATCCATGATTAGAGATTTAACACAATCTGAGTTACTGTGTGTTAGTATAGTAGNATGTTTATTAAGGAACATAA TATTGCTACTACTTCCGATAGTTTCAAGACTTTTTTGTAGGCTTGCTGAGGATTCATCCGCGTTATTTTCGATTACATTT TTAAGTACATGGAAGTTCTTTAACGNACAAATTTTTAAATAAACATAAACATNAAAATNAAAAAAAAAACCAAAATAAAA AAAAAAAAAAAACATATTATATGTGATATGATATATGTAATGTGTAATATGTAATATTTTATATGTAATATGNTATTAAC ATTGCATGCGNNTGTTTCTTATATCTTCCTTCTTTTTTCTTTTTTCTTTTTTCTTCTTTTTTTTTTCTTTTTTTTTGTTT TTATAAAGATGAATGTTAAAATTCCAGAATTTTTAACTGATGAAAATCACCCAGTAGGTTATTGTGTTAATGGTATACAA ACTTTTGTTGAGGATAGCGTAAGGCTAATAAGGAAATGTACCAAGCCCAATAAAAAAGAATATACAAACATAGTATATGC TTGCTCTTTCGGTTTTTTGATTATGGGATTTATTGGATATATAATAAAGCTTGTATTTATTCCTATAAATAACATTTTTG TTGGATCTTATTAACATACGAAAATTGGAAGGATAGATAAAAAGAAAATGAATAGGTAATAGGAATGGATAGCATGAAAA AATTAAAATAAATATAACATAATATAACATAATATAATATAACATGACAGAACAGAACAAAATTACNACTTTATTTTGAA CGGAGTTGGCAGCAAAACGGATTTAATGAACATTATTATTTATGTTAAATATATATTATATATATATATATGTTTTCTGA CTTGTTCATATTTTTTTTTTGGTATTACATATATGCAAAATTTTTTAATATATATATATATATATATTGCACACATATAT ATATATATATTTATATTTCGGTTGNCAACTTTACNTTAAATACTATTAATGTGTNCCAAACCTTTATNCCATTATATATA TATATATATATATATATATATATATATATATATTTATATATTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_524: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046701674854N978201346C3czapPFDd2.1, Debopam Chakrabarti
11998982320140AA5498880961m3gmbPfHB3.1, G. Roman Reddy
12003022320544AA5502921421m3gmbPfHB3.1, G. Roman Reddy


Date: 6:55:10 on Tue 21 Nov 117.