CPlasFal_533


Sequence

>CPlasFal_533 (14 EST) Length=1330 ATTTTATTTTTAAAAAAAAAAAAAAANAAAAAAAAACAATATNTTATATATGCACCGCCAGTACAATGTTATTCTTTTTA ATTTAATTTCCTGAACATTTGTTCACATTAATTAATAACTTAATATTACATTTAATATATTATACTTTTTATTTTACTTC TCATAAAGATCAACGAGACGACGTGGGAAAATATAAGCAAAAAAAAGATTTGGTATTTAAAAAATATATCAGAACAAAAT CACAATCCTTTTTTTTTAGGTTATATAAAAAATGCTTTAATATTTTTTTGTTATATGCCTTTGCCCTTTATATTCCTTGA GAAAATTAGGGACTTTTGTTTGGGCCTATTTTTTACATCCAATATGATAACCTATGGAAAAGAGGGTGAAATAATATGGA TAGAGGAGTAAAACAAAAAAAAAAAAAAAAAAATTTAAAAAAAAAAAAAAAATTTACTGAAACATATATATATATATATA TATATATATTTATTTATTTATTTTTTTTATAATAGAAAAACATATTATTAAAGGTTTTGTTGTATAATCTAAAAATTGTT ACTTTTAATTTTCATACTTTTTAAATTTGATTCTAAACATTTCATAAAATATTATATACAATGAATAGAATATTGTCCGT TTCATTTTATTTGTTTTTTTTATATTTATATATATATAAAACTTATGGAAAAGTTAAAAATACAGATCAAGAAATATCAA ATATCTATGGAACAAATTATTATTTAAGAAATGGATTCCTTAATGGAAAAAATGGTAAAGGAAACAAATATGAAGATTTA CAAGAAGAAGGAGAAGGTGAAAATGACGATGAAGAGCATTCAAACAGTGAAGAATCCGATAATGATGAAGAAAATGAAAT AATAGTAGGCCAAAATGGAACAGGAGGACCAGGAAAGTGAAGGTCCAAAAGGAACAGGAGGACCAGGAAGTGAAGGTCCA AAAGGAACAGGAGGACCAGGAAGTGAAGGTCCAAAAGGAACAGGAGGACCAGGAAGTGAAGGTCCAAAAGGAACAGGAGG NCCAGGAAGTGAAGGTCCAAAAGGAACAGGAGGACCAGGNAGTGAAGGTCCAAAAGGAACAGAAGGTCCAAAAGGAACAG GAGGACCAGGAAGTGAAGCAGGAACTGAAGGACCAAAAGGAACAGGAGGACCAGGAAGTGATGGAGAACATTCACATAAT AAGAAAAAATCAAAAAAAAGTATAATGAATATGTTAATTGGAGTGTGATTCCTTCACTAATGTCAATTATTATGAGAAGG ATTTTTTTAAATATATATGTGGATTTTTTAGNTAAAAAGTATAATTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_533: (14 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44148462895T181090652c3czapPFDd2.1, Debopam Chakrabarti
44216462963T181770781c3czapPFDd2.1, Debopam Chakrabarti
44223462970T181840791c3czapPFDd2.1, Debopam Chakrabarti
44284463031T182450903c3czapPFDd2.1, Debopam Chakrabarti
5042181400079N973700393M3gmbPfHB3.1, G. Roman Reddy
5042271400088N973790432M3gmbPfHB3.1, G. Roman Reddy
5044921674676N976580777C3czapPFDd2.1, Debopam Chakrabarti
5045131674697N976790892C3czapPFDd2.1, Debopam Chakrabarti
5046491674833N978151310C3czapPFDd2.1, Debopam Chakrabarti
5048051674989N979551716C3czapPFDd2.1, Debopam Chakrabarti
5048241675008N979741737C3czapPFDd2.1, Debopam Chakrabarti
12000102320252AA5500001079m3gmbPfHB3.1, G. Roman Reddy
12000202320262AA5500101089m3gmbPfHB3.1, G. Roman Reddy
12005762320818AA5505661730m3gmbPfHB3.1, G. Roman Reddy


Date: 10:41:41 on Mon 20 Nov 117.