CPlasFal_540


Sequence

>CPlasFal_540 (2 EST) Length=790 ATATTTATTTATTTATATGTATGTATTCATTTTAATGTGAAACCCCTAAACAGCTTTATTTTTCTCTTTCCATATTAAGT TATTGGTGGCTATTTAATAAATGCATATGCACATGTGTAGTTAAATTTTCTTCATATAAATATATTTATATAATATATAT TTAAAGGAATATATAGTTCATAAAATATATAGTAATGTAAAATTATATGATCGATACACTAGTTACATACACTAATGCTT ACAAATCATACAAGACGATACGTTTTAAAAATAAATTGTTTATTTATTTTATGTGCACATATAAAAAAAAAAAATATATA TATATATATAAAAACTATTCATATATATGTATTAATATAGTCTGATTTTTTTGTGTGTGATATATATTCGCTTATATTGT TATTATCTAAACAATTATAACTACAGCATTTTTTCAAAAAAAAAAAAAAAAAAAAAAATCATACATATAATTAATTACAT ATTAATATATACAAATTTAATGGCTTAAAATAATAGNACATTCATATAACGATTATTTTTTTTTTTTTTCATTATTATTT GTATTATTTTTATTGTTTATTCTGATAAATTCATTAGCAAAATGGTTTAATTTTTTTTTATCCTCTACACTATGTTGAAG AAAAGTATATATTTCATCAGCTTTTTTAAAATTTTTCAAAAAATTTAGCAATGAATCATCCAAGGGTAATTTGCACAATG CTGTTAACTGCTTTAAATCTGTTGCTTGGTGTTCATGGGAAATTGATTTTTTCTTATTTTCGGATTTAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CPlasFal_540: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049981675182N981322227C3czapPFDd2.1, Debopam Chakrabarti
12005062320748AA5504961651m3gmbPfHB3.1, G. Roman Reddy


Date: 18:29:22 on Sat 18 Nov 117.