CPlasFal_544


Sequence

>CPlasFal_544 (2 EST) Length=679 AACAGCAGTACCAGCAGCAACATTACCAGCGAATTCTGTAGCTGCAGAGGAAAGGGCGCACGCACCAACACTTCCAATAC AACCTGTTTTTAAATTATCTAAATAATTATCATGTACTTTATTTGTTGAAGATAATTTGTCGGATGAATTCTTATTTATA CATTCACAAGATTTGTCATTTTTATCATTTGATTTGTGATTTTCATTGGTGTACATATCAGATTTTGCATAATATGATTT TCATCACCAGACATTTTTTCATATATTTTCAATAATTCCTTCTCTATCTTAGACATTTCCTGTTCACTATTTCTACTTCT ACTTTTTGTTTCTTTTTTTTCTAATAGTTCATGTAATTGTTTATATGTATCATTAGATTGGTGGTATTTTTCCATGGCTT CCGCGTCCAACCGGTCAATTATTTTTTTCAGTTCTGGATCATTTTGATAATGTAGATTGTGGGGTTTCTCTGTTTCTGCT AAGCATCTTGATTTTAATATTTTTCATTGGGTGTAATTGTTTATGAGACTTTTATTACGAAGGTTATTTTGACAATTTAC CTTGTACTTTNCCAAAANCCTNAAAANCGAAGGTATGTATCATTTTACTTGAGCTTGAAAAATTTTTTAACAAAAAATTT CTGTTGGATATATATTTTGTCTGAGGAAATAAAAGAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_544: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44172462919T181330693c3czapPFDd2.1, Debopam Chakrabarti
5047711674955N979371567C3czapPFDd2.1, Debopam Chakrabarti


Date: 17:58:16 on Tue 21 Nov 117.