CPlasFal_545


Sequence

>CPlasFal_545 (2 EST) Length=644 GGAATATGTAGAAATTAACATGGCCAAATTAGACGTATTAAAATACTCACATTTCCTTTTTATTAAAGGAATAAAATTAT CATATAAATTTGTATCATATCTAACTTTACTTAAACAAAATAAAAATGAAGCAATTTCATTAACTTCAAAATCATTTATT AGTTCATAAGATCGTTTTTCAATTCTTTTCCATAATAAATTATTTTGTACATTTTCTTTTAATAACATATTTGAAAAAAT ACAAAGAACAGAAGAATTCATACGACTTATATTTACAAATCCATTTTCATATGATACACATTCTTCTCTTTCTTTTTTGT ATAACCCATTCCCTCTAAGATTTGAAATGAATCGATTCTGCAAACGCAAATATTTAATTGTATGACCTCCTGTGTTTCTT TTAAACACATTCATAAACATAAGCATTGATGGGAAAAAATTTTTTTTCTTTTTTTCTTTCTTTAATTGTATTCTTAACAT TATTTACATATTTGTTAATATAATTTTTATATGCTTCTTCAAAAATATCATAATAATTATTATCAAAACATTCAACGTTT TTAGATATACTCTCTATATTAATATGATCTGTTACATTTTTTATNTTTACACGTTCTTTCACATTCTCAAAATTTATTTT ATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_545: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047571674941N979231544C3czapPFDd2.1, Debopam Chakrabarti
12000902320332AA5500801177m3gmbPfHB3.1, G. Roman Reddy


Date: 1:22:25 on Tue 21 Nov 117.