CPlasFal_549


Sequence

>CPlasFal_549 (2 EST) Length=713 TTTGGCCTGGTAAAATTAATTAAGGCCCTGGACATGGGACCTTGATAATTGATGGGGTTTACCTNCTTTGGTACCAATTT TTTTTTTGCNCCTGGAAGTACCCTTCCTTGGTGGCCNCCCTTGTTANTTTTATGTAAATGAATACCTAAACCTACTGCAC CTCCAATAAGTAAAGCAACAGCAGAGGCTATAGAACTGTATATCATTATATTTTGATTTCTCTTNTTCCNTTCTGCTGGT GTTAATTTTTTGGCTGGCTTTGCTTCTACCATGCTATTGTAATCTCTTGGGGCAATGAAGTTGAGAGCTAAGAGGGCTGC GAAGAAATATAAGATTTTGGAGAGTTTCATTTTGAATAATATAGAATAAAATTAAATAAATTATTGATATATAAATCAAA GGTGGGAGATATGATAAGATTGGTATTAATAAAAATCCAATAAAAAATAAGATAGAATAATAAAGATTATTTATTTTTAC AAAAACAAGTAAATATATCTTTTATTAAAAAGGTATATATAAAAAATTATATATATATTAAAAATTATTAAAGAAAAATT CTTTACTAAATTTTAAAAAAAATAAAAATTTTAAAAATTAATTTTTTTTTTTAATTTTAAAAAAATAAAAAATAAAAATA AAAATTATTTTAAAAAAAATAAAATAAAATAAAATTTTTTAAAATTTTAAAAACTGAAAAACAAAAACAAANA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_549: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2973319307T027910133M7gmbPfHB3.1, G. Roman Reddy
5045781674762N977441186C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:24:16 on Sat 18 Nov 117.