CPlasFal_554


Sequence

>CPlasFal_554 (2 EST) Length=856 TATATATATATAAGGTGTATATATCTACTTTTTATTATTATTCTATTAAATAAGGTCGAAACGGTTATTTCCATTTTGCC CAGGAGGGAAATGCAGTTTTTGGAACTCCTTGTGTCGAAATTATTAGTAATATATAAATTGATAGATTAATATTTTAATA AATGAAAAAAAAAAAATATCTAATTATTTATATTAATTAATATGATCGGTTATTATTTTTTTTAAAGAATGTGTTATATG GATGAATAGTTATAACAAATTAATACTTTTATTTTATTTTATTTGTAGATAAAGCAAGAAGGTTCTTCCCTTAGAATTTA TGATTTACTAAAANAGACAAGACAGAAAGTGAAGAATACTTATACTTTTCAACCCAGCGCTTTTGTATTTTATGATGTAA ATATGGGAAACAAAAAAAAAAAAAAAAAAAAAAAAAATATAATATAATATAATATAATATAATATATATGTACATTTATA TATTATTTTTATTTTTGTTCAGGTGATACATTAACAATGCAGGCGAATTTAATATCATTTAAATCATCCCTAGGTATTGC AAAATTGAGTGGAGTTGGTTATGTAAATGGTAAAGTAGTAATAAATATATCAGAAATGACGTTTGCCTTATCGAAATAAG TTTTAAAAAAAAATTAAACTTATAACGAATATGTAATTCTTTTAAGAATTTAGAAAAAAAAAAAAAAAGAAAAAGACAAA ATAAAAATTAAAACATTTTCATGCCATTTTGGACATAATAGATAAATCTATAAAAAAAAAAAGAAAAAGAAATAATAACT CAAACGAATAAGAATCAATAATATATACAATAAAAATGTGCAAATTAATTTTATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CPlasFal_554: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004742320716AA5504641617m3gmbPfHB3.1, G. Roman Reddy
12007042320946AA5506941931m3gmbPfHB3.1, G. Roman Reddy


Date: 22:8:20 on Fri 17 Nov 117.