CPlasFal_555


Sequence

>CPlasFal_555 (3 EST) Length=662 TTATTGTTATGGTTGTACCACAAAATTGTATTCATTATTAAACGTTTCAATTGAATGAACTCTCTCTGGGCTACATTTTA TTTTCTCTTCATCTTCGTTGTCATAAAAAACGTTTACTTTTAACTGTTTTAAAAAGGAAATATGAAAAAATAATTAAATA CTAAAAATATATATATTACGTATAAAGCATATTTTATTTTATTTCATTTTATTTTATATTTTTTTTATTTTTTTTTTTTA TTTTTCTTTTATTTGCATACATTAACTACATTCTTAGACGAATCATTCAAAAGATGTAATGACTTTAATTTTACTTTAAG AGAAAAATTATTCTTAACTTTAGGGATACTTATAGACATTTTTAATTTGTTGAATAAAAGTATTTCATCGTTTTTAATAA GACATAATATAGAATTGNTTTTCTATATAATGAAAAAAAAAATATACACATATATAAATATATTTTTAAATANAAATNNA AAATATTTATAATTAAAAAATAAAAAATAATATCACTCATTTTTTGAAATTATGAATGAATGTATTATCATAATATCAAT AAATTTACAATTTTTTTTTTTTTTTCTTTTTTTCTTTTTTNCTTTTTTTTTTTTTGGGTGTATCTNTTTNAAAGTATGAA AGTAGTTCANAGTATAAAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_555: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28721319457T096250206m3gmbPfHB3.1, G. Roman Reddy
5042121400073N973640362M7gmbPfHB3.1, G. Roman Reddy
11999292320171AA5499190992m3gmbPfHB3.1, G. Roman Reddy


Date: 9:18:59 on Sun 19 Nov 117.