CPlasFal_557


Sequence

>CPlasFal_557 (3 EST) Length=484 TATATATATTTTTATTTCATTATCATTATATTATATATCAAGATGGCTGATACAAATGGAAGAAATAGTATCGTAGGGCA CGAGGAATTATGGAGCTGCTTATAACCAAGGAGGATATAATTATTCACAAAATAAAGACAAAGAAAATTATGACAAATCA AACAGTGGACAGAAAGGATATTATTATGATGCCAGAACAAATATAACAGCAAATGGTGGATTGTATGATGAATTTTCACT TAACGAATTTTCATCAACAAAAATAAGACATGGATTTATAAGAAAAGTATATTCCATATTATCTCTTCAATTATTATTAA CATTTGGATGTGCAGCATTAGCAGTATTATATAAACCATTTAATGCTTTTGTNCTTACCTATTATTCTCCTTTATTTATA GTTGGTGTTTTATTAAGTTTGCCTATTATGATAGCTTTAGCTTGTGCACCTCATATGGCAAGNAAATATCCAAGTAAATT ATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_557: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2703271376T025220132C3cbsPfHB3.1, Debopam Chakrabarti
2713271386T025320145C3cbsPfHB3.1, Debopam Chakrabarti
12006162320858AA5506061775m3gmbPfHB3.1, G. Roman Reddy


Date: 11:56:36 on Wed 22 Nov 117.