CPlasFal_558


Sequence

>CPlasFal_558 (2 EST) Length=861 TATATATATATATATGGGCGTATATATTTATGTTTGCGTTTTATGTTTACCTTTAAAGTCATTGGGTATTTGCGAGTTAA GGTTCAACAAATTCAAGTGAGACGTTTTAGCCTCACCCTGTTGTTTTTTTAAATGACCTACATTAGCTGTCTCAAAATTT TTCCTATGTTGAATGGCTAACCGACGAGCTTCTTCAAATCCAAATTTATATACTGGGAAATATCTGTTAATACATCGTCC ATTAATACATATACCAGATAGCCATCTATTTTGTGACTTATCAAATCTAACCCCAACAACATGAGGTAATTTTTCAGCCA TTTTTGCATAATTTATTTCGTTATTATTAGGTACATGTCTACTACGATTATTACTACTAGATGTATTACAATTATTCTTA TTAGATCCATTTGCACTTACAATATCTTTTTTATTATTATTATTATTAGGATCATTATTATCATTATTTTTACCAGTTCC TTCTTTTTTATTTTTGTAGGAATTATCATTTTTATTATGATAAATTAAAGTATCTTCTGTTTCATTTTCATTACCTGAGA AACTTAAAAAGTTTATAAAACGTCTGAACATACTTGGTGATTCTTTATTATTATTATTATTATAATTGATTTCTTCGTCA TTCATACTATTACTATTATTATTACTATTATTATTATTATTATTATTATTGTTGAGTATGTTTATGTCTACATTTGGATT ATTTCCTCCTTTTTGTTGTGTATTTTCTTTTTCCTTTTTGGATTTTTTACCATAATATAATGTCCCCGTTCCATCATAAA GGTTTGTATTTTCCTCCTTGTTTACCTTTTGATTTAATTCAATAAGAGATTCTTTTTTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_558: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046911674875N978571394C3czapPFDd2.1, Debopam Chakrabarti
12001372320379AA5501271229m3gmbPfHB3.1, G. Roman Reddy


Date: 18:2:6 on Fri 17 Nov 117.