CPlasFal_561


Sequence

>CPlasFal_561 (3 EST) Length=461 AAACAATGAAATTAATAAATAGTTATGAATGTCACTGGTTTACTAGTTACGAAAACTTCAAAATCTTATGGATGCACGCA TCAAGTAATTTGGGTACTGGTACTTACTTAAAGAATTTCTTCTCCGAATTGTGGCAAAACATTCGTTTCTTATTTAAGAG CAAACTTAAGATCCGTGATATGGAATATTTTTCAGGTGATATATCACAAATGAACTTATTAGATTACTACTCTCCTATGG TACATTCCGAATCTCACTGTCAAGAAAAGATGCAAGTTTTATTTATAACATTAAGAGATAGCAAAGAAGAAAATCGTAGT GAAATAGCTCAAAAAGTTAAGAGTGCATATTACCAATGTAAATTAGATTACTCTAAGAATCATCACAGCGATTTTATCCA CAGAATACATCCAAATGATTTCTTAAATAATAAGGTGTATGTCTTAAAACAACCATATTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_561: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5045331674717N981601102C3czapPFDd2.1, Debopam Chakrabarti
5047691674953N979351565C3czapPFDd2.1, Debopam Chakrabarti
5048061674990N979561717C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:18:47 on Wed 22 Nov 117.