CPlasFal_572


Sequence

>CPlasFal_572 (2 EST) Length=557 TATATAAATTCACATTTTATTGTTTAGAATTAATATAAATTCTTTTTTTTTTTTTTTTCTTATTATTTACAACATATTTG TGAATCCATCCTTATTGTGTGTGTACTACTCAAAAACGTTTCTTTCTTTTTATGCATGAAGAAAATTTCTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTGAACCTTTAATCTTGATTAAGAGAAAAAACATATTCCTTTTTTTTTAAAAGAATTAATG AATACAAATAAATTATGTGCATAATACATAAGAAGATTTTATTTGTAAATGTAATAAAAGAGTGAATTATATACCTTTAT ATTGTATGCACAAAAATAAATTATAGTAAAATAAAAATAGGATTCCACCATTATAAGAATTATAAAAAATATAAAAATAA TACATATATATAAATATATATATATATATATATATTACAGAATTCATTTAAATATTAGCAAGTTTTAAACTTTTAAACCT ATGAAATCAAACAGTTGATAACTTTCCTTCTCAAAAAAAAAAAAAAAAAAACTCGAGACTAGCTCTCTCCTCGTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_572: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2746271419T025650196C3cbsPfHB3.1, Debopam Chakrabarti
12006592320901AA5506491838m3gmbPfHB3.1, G. Roman Reddy


Date: 21:33:59 on Fri 24 Nov 117.