CPlasFal_585


Sequence

>CPlasFal_585 (2 EST) Length=478 TTACCATTGAATTACAAGATATAGAAAATGTAAAGATTGACCTAAAAGAAGATAAGTTGTATTTTTATGGTACAAAAGAT AAGAATGAATATGAATTTACATTAAATTTTTTAAAGCCAATAAATGTTGAGGAATCAAAGTATAGCACGCAGAAGAAATA TAAAATTTAAAATAATAAAAAAAGAACAAGAAAGATGGAAAACTTTAAATAACGATGGAAAGAAACACTGGGTTAAATGT GACTGGAACTCCTGGGTAGATACCGATGAAGAAGATAAAGCAAATGATTATAATGATATGGGTATGAACAGTTTTGGTGG TATGGGAGGTATGCCAGATATGAGTCAATTTGGAAATATGGGCGGATTAGGAAATATGGGAGGTTTAGGAAATATGGGAG GTTTAGGAAATATGGGAGGTTTAGGTAATATGGGAGGTTTAGGAAATATGGGGGTATGGGTGACTTAGATTTTNGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_585: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2769271442T025880233C3cbsPfHB3.1, Debopam Chakrabarti
5047611674945N979271552C3czapPFDd2.1, Debopam Chakrabarti


Date: 20:43:46 on Thu 23 Nov 117.