CPlasFal_594


Sequence

>CPlasFal_594 (2 EST) Length=445 CTTATTATGGTCATCATAATTTCTTCTATTTTCTTCATATAAATTATTCGAATTATCACTAAGCTCATGATCAAAAAAAG AATATTCACTATTTGAATCTTGTGATGCACAAATACTTTTAGTACTATCAATATAGCTAGAATTTTCTTCTTTGGAATAA TAAGTTCCTTCCTTTTTTTGTTCATCATTATGATCATATTTTCTTTTGTATTTTTCATGACCAAAATAGGATTAACATTA TTATTATTACTTATTATATTATCTTCGACCCATTTCCTTGAACTATCATTACAGTTTAACTTATTATAATAAACAAACTT ATCTTCAACATCTTGTGAGAACGCCAAGAAAATATAACTAAAATATAAATAACTTTTCATCTCATCTTTAAAATAAAAAT CTTGGGATTTTTGCCTAAATCCAAGAAAGAGCAAATCTTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_594: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002742320516AA5502641386m3gmbPfHB3.1, G. Roman Reddy
12002772320519AA5502671394m3gmbPfHB3.1, G. Roman Reddy


Date: 2:22:24 on Thu 23 Nov 117.