CPlasFal_601


Sequence

>CPlasFal_601 (2 EST) Length=753 ATTCTTGTTAATGTTTTTAATTAGTACGTTTTATTATATTTAACCTTATAAAAAATTAGGGATTTTGTTGTTATATAATA TTAGCCTTGGGTTTCACCAAAACACGAAAATCGTATATTAAATATATATACATATATATTTATATTTATATATATTTATA TACATTTATATACATTTATATATGTATAATGAAGAATATATTAATTTTTAGTTAATAATTCTAAGTTAAAAAAATAAATA TAAAAATAAAAATAGTATACATTCTTTAAAGAGGAATTATGGATAATCAACGAAACATGGAAGATGCTCAAAATGCTTTA GGAATGATGATTTATCAGATTTTAAACAATCAAGTGAGAAAGACATGTTTTGATAAATGCTTTGGACAGAAGTTTTCTGA ACAAATGGGAAAAAATGAGCAAATTTGTTTAGCAAAATCCATGGNCAGAATGNGCGNAACACATACAATTGTAACCAAGG CGTCCCCAGAAATTTCCCAAAATTTAAATATGGATNCAAATTTTTAAGTTAATAATTCGATATTTAAAAAAGNCAAAAAA TAAAAATATTTAAGTTTTTTTTTTTTTTTTAAATATGATTTTTTAATTTGCTTATTTTTATTATTTTTTTTTATTTATTG TTAATTAGATTTAAAATAAAAATATATATATATATATTTATTTATTTATTTATATTTATACTTACATATATAGACAATTT GTATAAATTAAAAAACAATAATAAATAGAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_601: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049641675148N980982176C3czapPFDd2.1, Debopam Chakrabarti
5049941675178N981282222C3czapPFDd2.1, Debopam Chakrabarti


Date: 22:17:33 on Sat 18 Nov 117.