CPlasFal_605


Sequence

>CPlasFal_605 (5 EST) Length=1381 TATACACACATACATACATATGTACATATATACATATATACATACATATATACATATATATAATGTCAAAGGAATGATCA TTTACGTTATAAAAATATATGATGAGTACTATATAAAATATACGGACATNTAAAACATATGCTTACATATACGTGTATAT CTTTATTTATTTTACATGTATTATATATTTTTTATGTTTTCTTTCTAGTAGACTGANATGGATATTATAAAAAATAATTT CCTTTTAATTTAAATTTATAAAATAAAAATACATATATATGTATATATATTTTTTTAAAAATACATTTTTATTTTATTAC TATTTCATTTTTTTTAATATATGATCATATATATATATATATATATATATATATTTTAGAATATATCTTATATTAAAAAT GAAATATATTTCNCGGATTAATATATTTGTATTTGTATTTGTATTTTTTTTTCTTTTTTCTTTTTTCTTTTTTTACCTTC GTGTGACCTAAATATTGATCCATTAAACTTGTCTATAGCTTCAAGCATATCATCTTTATTAAAGAAGGATACCTCACCAG TACCATCTTTAAATACATCTGCATGACCACATTCACCTGCTTCTCTCAAGTGACCCTTTAAAATCTNTGGCCAGGCTACC AAGGATATTGGGTAATCCCTGGTAACCGTCAACTACATAATCTNCCTCTCCGTGATTTTGGGACCTCTATGCATCATACC CCTTCCACCACCTCTTGCGTTATATCTTCCATTTTCTCTAGCATTAAAAGGTACTTCTACTCTTAATTTNATTTCCTTCA AAATCACAACCATCTGTTTCTTTTATTGCATCTGCTGCATCTCGTGCATCCTCAAATTCTATAAATGCAAAGGCAGCTCC TGATACTGTTTTTTTTACATCACACTTTAATATATTACCATACTTACGAAATTCATTTTCTACATCTCTTGAAGAGACAT GTGATGGCAAATTACCAACATATATTCTCGATACACTTTCACGTATAACCATTTTTTATTATTTTTATTTTTTATGTATA ATAATGTAGATATAATATTATTCAAGTATTTATNTAATTTTCACTTTTTTAATTCTNNATATATATATATATATATATAT ATATATATATATATGTCTATGTATTATTTTTTTTTCTTTTTGTAAGTCTAATGGAGGTTTGTCAAGCTTTGCAAGATGTA ATTCGTTAGAGGAAAAAAACGCTTATCTTATGGGGATAAAGAAGTAATGAATATATAATATAACTGAAATTGAATTATCA TCAGAATTAGCACCACCAGAAATGCAAACAAAATTTGATAAGACTCAATTGAAAAATTTTTGTGTGAAAGATGACACAAA AAAATTTGATTTCATAGCGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CPlasFal_605: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2945763438T027630100M7gmbPfHB3.1, G. Roman Reddy
28714319450T096180202m7gmbPfHB3.1, G. Roman Reddy
5048691675053N980192046C3czapPFDd2.1, Debopam Chakrabarti
5048721675056N980222068C3czapPFDd2.1, Debopam Chakrabarti
12006492320891AA5506391828m3gmbPfHB3.1, G. Roman Reddy


Date: 18:43:50 on Thu 23 Nov 117.