CPlasFal_621


Sequence

>CPlasFal_621 (4 EST) Length=669 CCTGGTGATGTTTTTTCCTCGCATGTTTTCCAGTTCACATTACATAAATTTACACATTTTTCATAATTCTCTGGATTAAA TGCATAGGATCTTGTACAAGAATGTTTCTTATTTACATCTTGTGTATCTATATATTTACGCATACCCATTCTTATTTTGC CATCCTTTATATGTTTTAATATGTGATAAACATGAACACGTTCTGAGACTTCATTTGAAGTTCCTGCAGATTCTAATGCA GTATTGCTTTCCTTTCCACTTTGTCCTGATCCTGCCGTATCTTGACCGAATATAATATAGTTGTTACCTAATTTTTTGTT GTTTTCATTATCTTCCTTTTCAGAGAATAAATTTTTCTTACCAACATTAAAATTCTTAAAGTAAAGGTTATGATAAAATT CTGGAGAGGCCTTTAAATAATAATCATATATTTTTGATTCTTTTTTAGTTGTTTTATTATTCATAGGTAAATCAACATTG AATATAACAACACTGTGAATAAAGTTAAAATGACAATGAGTTGGTCCATACATATCTACTTTAAAATAACCTTCATCTCC CCAATATGGACCCCAACTGTTTCTTACAATCCAATAGGATTTTTTTTCTCCTTCGCTATTCACATAATTACCATAACCAA CAATATTAACTGCATGATCAGCTGTATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_621: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44288463035T182490422c3cbsPfHB3.1, Debopam Chakrabarti
5047341674918N979001474C3czapPFDd2.1, Debopam Chakrabarti
5048801675064N980302083C3czapPFDd2.1, Debopam Chakrabarti
5049611675145N980952173C3czapPFDd2.1, Debopam Chakrabarti


Date: 16:49:27 on Wed 22 Nov 117.