CPlasFal_623


Sequence

>CPlasFal_623 (2 EST) Length=739 AATAAGCGATATATCAAAATTGTATAAAGACGCATTCAATAATAAATATAAAATATTATATATATTCAGATGAAAAGGTA AATGTGTTATTATCATAATATTTTTATGTACACACTTATCAACATATATTAATTTATTGTAACAAAAAATTCCAAAAATT CTTAAAAAATCACTAGTGGCCATGTCAGCTGATTTAGAATCATAAAATTCTATAATACCATATAATTGTGTACTCTGGTT TGGATTAACAATTTTGTTTATTTTTTGAGGGTACTTTTTTTTTACATTTTCATTTTGAGGGTTCTTATTAGATATATTGT AATTACATATGTTATCAATGTTTTGTTGAATATTATCATTATTGTTATTATTATTATTGTCCATATTATTATTATTATTG TCCATATTATTATTATTATTGTCCATATTATTATTATTATTATCATTATNACGTATACTTAATCTTTTCTTTAGGGTCAT GTTATGAAAATAATCCAAGAGATATTCAAGCGATTCTCTATCAATTCCGGCCTGGAAATCTGAATAATTATTTTCAATAA TTGCATCTGTATTTATTGGTAATTTTATTCTATTCTTATTCTTATCTATTACTAACCCCACCCTTCCTTCAATTTCAATT TGAATATCTTTATTATTTATATTCTCATGATTGTCGAAAGCCAATATTATATTCTGAGATAATTCGTATGTTATCTTATC AATCGGTATAGGTCTACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CPlasFal_623: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044331674617N975991032C3czapPFDd2.1, Debopam Chakrabarti
12003282320570AA5503181459m3gmbPfHB3.1, G. Roman Reddy


Date: 8:17:54 on Thu 23 Nov 117.