CPlasFal_627


Sequence

>CPlasFal_627 (4 EST) Length=621 CCCCANGGATCCCACACCGAAAANACCACCAAAAGGNTNAAAAAAATGGNGAAAACCTTGGCCTGGTAAAAGTNCNTAAA GGGACCCNAATAACCCACCGGATATATAAGNTTAANGGAATACCGTTTGGGATCTATAGGTTGATGTTTTGCTGCTNTTG CTGCTCTANNNTTTTCTGCCTGAGACGATTGTATTTTTAATGGTCGATTTTTTAACATCATGCCATTTGCTGCTAATGCT TTTATTACTGCTTCTTGAGTGTAAAATTCTACATATGCTACTCCTTTTGATTTTCCTGACCTTTGATCTTTTATACATTG TATATCCCTAACCTTTCCAGCTACTTCTGAAAAAAATTCATATATATCTCTTTCATCTGCTTTTAAATCCAAATTTAATA CAAGTACTGTTAAATCATCCCTTTTTGCTTCTTCCATTTCTTCTTTTAATCTTCTTTCTTCTCTTATTTTTTCTCTTCTT TCTCTTTCCAGTTCTCTTTCTTTCCTTAATCTTTCTCTTTCATTTTCTCTTCTTATTCTTTCTTTTTCCCTTTCCCTTTC TCTTTACCTTTCTCTATCTTTTCTTCGCTCTCTTTCTCTATCTCTATATCGATCACGTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_627: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2805271478T026240282C3cbsPfHB3.1, Debopam Chakrabarti
5044801674664N976460755C3czapPFDd2.1, Debopam Chakrabarti
5046091674793N977751242C3czapPFDd2.1, Debopam Chakrabarti
5048841675068N980342092C3czapPFDd2.1, Debopam Chakrabarti


Date: 17:13:1 on Fri 24 Nov 117.