CPlasFal_63


Sequence

>CPlasFal_63 (3 EST) Length=928 AATATAGGAATCAATAATGAAAATAAAATTGAAGCTAATGATGAAAATATAACAAATTCATTAAGTGAATCATTTATTAA TAAATTAGTATTTTGTTCTAATACCCCAAATCATAAAAAAAAAGAGATTCATTATTTTTTTTTATGCGCTAAATTATTTT CTTTAAACCGAATGAATTTTCTATTTGTCATAAAATATGTGTCTACCTTCATACTCATGTTCGCATATTCATTATATAAT ATAATCAAAAGAAAACTCCGTTATAAATATTTTTATTATTCATCTTATTATATGAATTCTTTTGATTTTGCTGCAGGGTT ATTAGCAGGAGGCATCTTTGTTTTATTATATGGAATTATCTTTTTCTGTATTAAACTATATAATAATACAATTAAAAACA AAAACAAAAATTTCCATTTTTATGATAATTATCCATTTATAAATGATGTTAAATGTATATGTGATGAAAATATAAAATTA AATATAAGAAATAATCCATACCTAAAAAATATTGCCATAAACTATTTTAATTCATATTATAATTATAAAAATCTTCTTCT TATAGGTCAAATGTTTTTGGTTATTATATGTATTTTTTCTTTTATTTTTTCTATTACTTCTATTTATGCCTTCGAATTAA ATAGACAATAATGTATANAATATATATATAATATATATTTATTTATTTATATTGTCATATATATGTAGACAAACTCGTCC CTTCTCCTCCTTTTTATTTATTAACATATTTTTCTTTTTTTTTCTTTTTGTTTTTCTTTAATTTTTTCTCGTGCGCTTAT AAATTTAAAACTTGACCAGGGAAGAATATGACATGAACATCAAAATATATGATAACAAATTTTTAAAAATTAAAAATATA GATTGATATAGCACAACATATATTATCACACATATATATATATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_63: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28879319615T097830369m3gmbPfHB3.1, G. Roman Reddy
28880319616T097840369m7gmbPfHB3.1, G. Roman Reddy
12002502320492AA5502401362m3gmbPfHB3.1, G. Roman Reddy


Date: 1:45:15 on Sat 18 Nov 117.