CPlasFal_636


Sequence

>CPlasFal_636 (2 EST) Length=746 TTAAATAAAAGTACAGGAATGGATGTGTTCTTAAAAAAACAAAGTTATACTAAAAATGATGACAGTATGTTTACAAAAGT ATATTCTAATGAAAATATTATTGATACACCAAATAAAAACAATAATTTAGATAAAACATTTAATGATAATATTTCTAATG AAAATAACAATTTTGGGTATTCTAAAAATGAAGAATCTAAAATAATGACACCTATTCAAAGTAATATGCATATACCAGTA ATAAGTAGAAGAGAAACAAAACCAACTAGTTTTGNTAATCTACATAAATTTTATGAAATTAAAAGAAATGAGACAAAAGA AATAAAATCTCTTAAGGTTGTATGGAATCCAAATAAAGATGCAGACAATCAAAATGATGGATACAAGCAACAACAATAAT AATAATAATAACAATAATTTAAACAAGTAAGTGGTATTGGTTCGATTTAGGTTATCCTACATTAATGTGTTTATATGAAA TATTAAAAAGTGAAAAAAATAATCAAACAAATATGAATCCAATATTTTTCAATACATGTTTTGACGATGTCCTTAATTAT TTTAATATATTTCAATACCTACCTAGAATTCATATAAATGATCAATTCGAAAATAATGTAAATGGAAAAATTCTTACGNA TAGTGAACATTTTGATATGAAAATGGTATCTATTATTTNNTTAGNTATGGTTAAANCTAATATTGTGTAGGTATTTATAT CCTNATATTTAAATGNCCCCGGGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_636: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2747271420T025660197C3cbsPfHB3.1, Debopam Chakrabarti
12001072320349AA5500971196m3gmbPfHB3.1, G. Roman Reddy


Date: 13:27:10 on Wed 22 Nov 117.