CPlasFal_638


Sequence

>CPlasFal_638 (2 EST) Length=503 ATTTATTTATTTATTTTTATTCCTTCGTGTAGTACCTCTTTTATATTAAATTGTGATAACTTGTTCATATATATTTTTTT AAGCTCATTACTAATTTATGCATTTAAAAAAAAAAATTATACAAAATGGGTNCACCAAGAAGAAGATTAGGACAACAAAA TAACAATAATAATAGTCCCTTTGCATTGAGTTCTTCTAATATATTTGGGTCGAACAATGAGATATTTGGAAGTAATTTTA TGCATACGCCTATGTCGAGTAGGAGGACAAAGAACAGTAAAAGTTTTTTAAATAGTATGTTGAATGAATCAAGATATTTA AATCAGAGTAATGCCGGGTTCCTCAATTTATTAAAATATGGACCATACCCCTTTTAGCCTATTTAGGAAGAGACTTAAAG GTGTGCCAAGAGCCTGAGTATTCGAGATGTTGGTAGAGAAGCTTTTATGGAAGATGTTGANTCAGGTCGTTTGCCTCATT TTATTGATAGTAATTTAGAACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_638: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28678319414T095820176m7gmbPfHB3.1, G. Roman Reddy
44142462889T181030622c3czapPFDd2.1, Debopam Chakrabarti


Date: 8:40:47 on Fri 24 Nov 117.