CPlasFal_643


Sequence

>CPlasFal_643 (3 EST) Length=641 ATGATATAATACAGAAAAATTATACATTAACATAATGTATTTAAAAAAAAAAAAGGAAAAAAAAAGGAGTGATCCTTGTT TTTAAATTAGAGAAAATCTTCTATAATTATGTGCAGTATTTTTTCTATATTATATTTTATGTGAAAAGAAGATTACCTAA AGGAATTAATGTGAACTTTGAAAAATATAATTTCGAAACATATATTTTATTTTATTATTTTGTATAGATGTGAAAAAAAT ATTTTCATGGTATTCTTAAATTATGTAATTTAAACCATTTTTAGAAATTATCTTATTATATATCGTTAAGATAATCATTA GAAAAGAAGAAAACATAATGATCAAAAATTAAGAAAAATATTTTAATGAAAATGTATTGCCAATATAATAAAAAATATAT TATATTGTTTCTAAGTATAAAGTTATGTATTCAAAAAAAAATTAAAAAAAGGTGCAAACAAATAGTGGTTTTCTCCATAC ACCATTTTTTATATAACAATAAAAGGATAATTAATTTTNAATTCAATTTTATCATACATATTTTTAATATAGATTAGTCA ATTTTATAAAAAANATGAAATTCATTAAATAANTCCAACACTAAATATATATATNNTTTTTTTCTGGCATCAACTAGTTT T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_643: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28727319463T096310209m3gmbPfHB3.1, G. Roman Reddy
11999182320160AA5499080981m3gmbPfHB3.1, G. Roman Reddy
11999202320162AA5499100983m3gmbPfHB3.1, G. Roman Reddy


Date: 10:55:48 on Tue 21 Nov 117.