CPlasFal_646


Sequence

>CPlasFal_646 (2 EST) Length=657 CTCGAGTTTNAATTTTTTTTTTTTTTTTTTTTATTTCTTCTTTAATATGTGGTGCTTTTTTAATATAAAATAAATATATA TATTATCTTAATTTACACATAAGTAATTTTAAATATATATTATGAAACTCATTTACATATTTGTTGTAGTAGTGGAAAAA AAATGCACAATATTTTTTAAAGTTTATCTAAATATTGANCTAATTGTGGCATTTCAACTTTAATACCTTTCCTTTCTCTG ATGTTCATAATAATTTTGTATGAGTTTTTGTTTGAACCAAATGGGACCGGCCATATAATACAGACCAGTGATCAAAGACC ACATTGNTGGGAAAGCTTTGACCAGATGTAGCAGCACGGTAAAGCTGAGGTGAAACCAAANTGATTCAGAGACAGGGTAA GTGAGATTGTATTTTTAATTAATGGAGTACCTAATTTCTGTTCTTCTGATATAACAATACCTCTTCTTTTGTTCAAAACA CCATACACACCACTAACAACATCTTGTGGACAACTGATATCGACAAGATAGATTGGTTCAACTAATCTTGGGAAAGCTGT TAATTNACATGCATAAATACATTTTTTACATGCAGGCATAATTTGTCCAGCACCTCTGTGGATAGCATCAGCGTGCATAT GAACATCTAACCTCGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_646: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2682267619T025010105C3cbsPfHB3.1, Debopam Chakrabarti
2683267620T025020105C7cbsPfHB3.1, Debopam Chakrabarti


Date: 2:49:29 on Sat 25 Nov 117.