CPlasFal_658


Sequence

>CPlasFal_658 (2 EST) Length=662 TGCTTATATTCCCTGTTACCTTGTGTAAAATCTCTGATTTTAATTTTCTCATTTTCTTTNCCAATTTCATTTGGGATGGT ACAGTTTTTATTTTCTTTGTTATATTTTGAGATGTNTCAATTTTCTTAACCGATTTCTCTTCATCTTTTGGATTATTATC ATTCAATATTGTTTTCTTAATAATTTTAGATTTTAATTTCTTAAATGATTTTGCTTCTTTTAATGGTCTATTATTTATTC CTTTATTTTTTTCTAAAACTCCTTTAGATATTATTGTTCCACTTTTTCCTAAAACTGATTTTTTTGTTTTATTATTATCC TTATCACCTAGCGAACTAATTTTTTTTATAGCAGAAGTGTTTGATTTGGTATTTAATTTTAATAATCTAGAACTTAATAA TTTTTTATTATTTAAGCCATTTTCCTTTTCTTCCATCTTTTTCTTTTTTAATTTTTCTTGTATCATTGTGTTCTTAGTGT TTGTAGAATTTAATGAAGCTAAAGTTTTATTCTTGTTTAATTTCATTCCGTTAACATCTACAGTTTTAAACTTACTCAAG GTTTTTTTCTTTTTTTTATTTAATGCAGATGCTGAGGTTTTAGAAAATGTGGAAGGTCCTTTTTTGGAAAGGGGTTTTTC AAGTAAATCTTCTTCTTGCATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_658: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046481674832N978141309C3czapPFDd2.1, Debopam Chakrabarti
5047511674935N979171535C3czapPFDd2.1, Debopam Chakrabarti


Date: 2:40:14 on Fri 24 Nov 117.