CPlasFal_668


Sequence

>CPlasFal_668 (2 EST) Length=418 TAAATATCAAAAGATGTAAAGCTTACAATTATGTCGTACAACATTCAAATGTTGTCCATTCCATTTAGTGTGCATTTGAA CAGCTAGACAAGAAGAAATGCAAGAATTGATTATATATGTTCACTTGATGATATATATGATATTGATATATTAGNTCTAA ATGAAGTGTTTACCAAAAAATGCTATAAACTTTTAACAAGTGGTAAAATAAAAGAGAAATTTCCTTACCACACAAATGTA ATAGGTCGCAATTACAAGCGCCATGATAATTACAATGATAGTTCATCAAGTACAGGACAAAAAGATGGCTTATCATTTCA TTCAAGTGATACAAATATAAATATTGAAAGTTCTCGTGGTATATCAAATTATGTAAGCGAACAGATGGAATACATACGAA AAAATAAGGAAAAATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_668: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5044721674656N976380741C3czapPFDd2.1, Debopam Chakrabarti
5046731674857N978231350C3czapPFDd2.1, Debopam Chakrabarti


Date: 8:15:44 on Wed 22 Nov 117.