CPlasFal_673


Sequence

>CPlasFal_673 (2 EST) Length=762 TGGGTACCCATCCAATATGTGTTTGAGTCGGATTTGTTTTNTAACAATCTCTATCATTATAACTTTTGTCTAAAGATATT AATATACTTTTTAATAAATGTATTAATGTGTTCCCATGTATTTAAAGAAACATCCCTTATTTTGTAAAAATAATATTTCA TTTCATTAAAACAAAGGGGTTGAAAATATNACAGAAGAAATAGAAATNATAAATTAATAAAACATCTTATTTTCATTCTC TTATGGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTCAGATATTATTTTTAATGCTTGCCTTCAATTGAGGTAG GGCAATGTGCATTTGATTTTCTTTCATATTTGAAAAAAGCTATATAGCATAAAATATATAAATTAATAAAATATATATAT ATATATATATATATATATATTCACTCCAACTTTATATTTCCAAAAGTCATATTGACTCAGATTAATAAAAATGAAACGAA TAATATATTAAAATATCCGAATTATTTTTATGTAATATCTTTATATAGAAAAAATGTAAGGTTTAAGAATAATAATGTTC TTAACAAGTCAGTTACCAAATTTGCTCTCAATACAAAAAAAAGGCACAAAGAAGCTTTAGCGATAAGAAAATATAGGATG ACAGGACCCTCATCCATTAAAAAACATTATGGATTTGGAGCACATAAGAGAATTAACAAAGTCACCATGTTACCACACAA AGAAATAAAATTACCAATAAGAAGGTGCGCTATATTGGGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CPlasFal_673: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046661674850N978161339C3czapPFDd2.1, Debopam Chakrabarti
12006232320865AA5506131785m3gmbPfHB3.1, G. Roman Reddy


Date: 19:12:57 on Thu 23 Nov 117.