CPlasFal_687


Sequence

>CPlasFal_687 (7 EST) Length=504 GGCACGAGTTTTTTCCCATTTATTTAATCATGACTTTGATTGAATACTTAAACTCTGATAAAACATTCCTGGAAAATAAT CAATATCACGGATGAAGGTGTAAAGGTTTACGAGTTCATTTTTGGAGAAAATTATATATCATCCGGAGGTTTGGAAGCTA CCAAAAAAATCTTGAGCGATATTGAACTTAATGAAAATTCGAAAGTTTTAGATATCGGATCTGGTTTAGGAGGTGGTTGT ATGTATATCAATGAGAAATACGGAGCACATACTCACGGTATAGATATATGTCCTAATATTGTAAATATGGCTAATGAAAG AGTTAGTGGAAATAACAAAATTATTTTCGAAGCTAATGATATATTAACAAAAGAATTTCCTGAGAATAATTTTGATTTAA TTTATTAGTAGGAGATGCAATATTACATTTATCTCTCGAAAATTAAAAATAAAATTTATTCCAGGAATTGCTACAAGTGG GTTAAAACCCATCAGGGTACCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_687: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2665267603T024850074C3cbsPfHB3.1, Debopam Chakrabarti
2728271401T025470164C3cbsPfHB3.1, Debopam Chakrabarti
2763271436T025820225C3cbsPfHB3.1, Debopam Chakrabarti
2765271438T025840227C3cbsPfHB3.1, Debopam Chakrabarti
44049462796T180100335c3cbsPfHB3.1, Debopam Chakrabarti
44083462830T180440407c3cbsPfHB3.1, Debopam Chakrabarti
5045771674761N977431184C3czapPFDd2.1, Debopam Chakrabarti


Date: 1:51:2 on Sat 18 Nov 117.