CPlasFal_688


Sequence

>CPlasFal_688 (2 EST) Length=463 ATATATAATTTTACATATAAGACAACTATAAATTAAAACAAATATTTTAATTAAAAACAAAAAAAAGAAGATGAATCAAG ACATCCATGTGTTATCTTAAAACAATATTCTCATATTATTTATTTTTTTGAATGGCATCCAAATTATAAGAATAAATTTT GTGTATATAAAATATATTTAAATATTCCTCTCTGGATTAAAAGGATATATACAATTATTCATTTTTGAAAAGGGACACAA GTAATATTTCTCTTTGCAAATATTTAAATATACGAAAATATAAGATTATTATATATACACAGTAATCATAACACTTTTAA TAAGTGAATGAATTACACATTTCATATTTCGGTAAGATAACACTTATATTTTTTTTACTCATAAGAATATATATAATCAT AATATATCATAAAAGAAACAAATGAAAAAAAAAAAAAAAAAAAAACGCGAGACTAGTTCTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CPlasFal_688: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44077462824T180380393c3cbsPfHB3.1, Debopam Chakrabarti
12001692320411AA5501591272m3gmbPfHB3.1, G. Roman Reddy


Date: 21:57:25 on Fri 17 Nov 117.