CPlasFal_695


Sequence

>CPlasFal_695 (3 EST) Length=781 TTGTTGATTTCCTTGTGCTAAATATATACTAGCATTAAATTCTTCAACAGTAGTTGTATTTTCATCTAATGGTTTGTTTA ATATTAATTTGAAGGTCATCTCTGATTTCTTTTCANCAAAAATAAAATTACGAGCACATGNAAAATTTATTAACACATAA CCTAAATTACCATCTCTTTTTAAACCTGAAAATTCATATTTCGTACATCTGCATGCTAAACCAGGAAATATTTTATCGGA AGCATTGGTAGCTATTTCGTAAAAGGTACCTTGTAAAATTTTTACGTCGATATTTTTACTTAAAACATGTACAACCCCAT CATTGTTAACATTGTTATTATCATTTCCAGGGGATGCTCTAATTATGGTAAATAAANNAAATATAAAAAATAAGGAAACT GCTTTTTTAATCATTTTCAAGGAAAAAAAATATAAGNAAAAATTACAAATAAAAATTATTCTTATTATAAATAAGTTCAA GATTCTTTTATATCTATATAAAATATAGNAAAATATATTATTTATAATTTTTATTTTATTATATATAAATATTTATATAT TTATGTATCTATTTATATTTATTTTAATATATCGAAATAAATATCATAAGTAAGAATACAAGTGAATATTTTATATACGT ATGGGTATCACAGCTGAAATAATCGGAAAGAGNCCAATTAGAATTTAAGGGATATAATTGTNGGTAATTATATTCAGGCA AAGGAGCAAAACTTGCAGCAGAAGCCATGGTAGTAAAACTTGGAGTAGTCGCACCTGTGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_695: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44039462786T180000319c3cbsPfHB3.1, Debopam Chakrabarti
44188462935T181490725c3czapPFDd2.1, Debopam Chakrabarti
5048631675047N980132040C3czapPFDd2.1, Debopam Chakrabarti


Date: 22:34:26 on Thu 23 Nov 117.