CPlasFal_699


Sequence

>CPlasFal_699 (2 EST) Length=422 AAAAAAGTAAAAGAAAATAACTTTTTCATAAATTATTATATTAATATTTTAGAAACCCTTATTTCTATTCTTATTTATAT TATAATATATATAAAAGGAAACTTTTTGTATTTTAAACATTTAAATCTCGAAAAAGAAAAAAATGGAGGATGCAAATAAG CCCAAGAAGAGAACCTTTCGTACCTTTCAATATAGAGGTGTTGATTTAGATAAGTTATTAGACTTAAGCCAAGATGAACT TATAAAATTATTTAAAGCAAGACAAAGAAGAAAGTTCCAAAGAGGAATAAGCAAGAAAGCTAAATCACTTTTAAAAAAAA TTAGAAAATCTAAAAAAAATTGTGAACCAGGAGAAAAGCCAAATCCTGTCCCTACCCATTTAAGAAATATGACCATCATA CCAGAAATGGTAGGATCTATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CPlasFal_699: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046401674824N978061289C3czapPFDd2.1, Debopam Chakrabarti
5049141675098N978402132C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:14:58 on Thu 23 Nov 117.